L'ANALISI TECNICA

Librerie di malware: tecniche e linee guida per capire l’evoluzione dei software malevoli

Le collezioni (librerie) di malware permettono ai ricercatori di sicurezza di testare gli antivirus e studiare i software malevoli conosciuti per riuscire ad identificarne di nuovi. Ecco le tecniche e le linee guida per creare librerie di malware sempre aggiornate

25 Ott 2018
S
Alessandro Sinibaldi

Esperto di sicurezza cibernetica presso il CERT-PA AgID

Un’attenta analisi dei malware ci fornisce tutti gli strumenti e le informazioni necessarie per studiare i comportamenti di questi software malevoli e classificarli in base a una serie di possibili schemi. Le librerie di malware, dette anche collezioni, sono uno strumento importantissimo in mano al ricercatore, allo stesso modo di un orto botanico, uno zoo o un acquario: può essere utilizzato per fare dei test su strumenti di sicurezza che dovrebbero riconoscerli, come gli antivirus, per sistematizzare tutta la conoscenza, a mo’ di enciclopedia, sui malware esistenti conosciuti e a fini didattici nelle facoltà di informatica per insegnare la struttura e il funzionamento di questi programmi.

Il Virus Test Center di Amburgo ha dato una serie di linee guida per chi volesse essere interessato a costruirsi una tale base di dati.

Le tre funzionalità principali delle librerie di malware (o threat library) sono le seguenti:

  • fornire posizioni organizzate, indicizzate e ricercabili per informazioni strutturate e non, relative alla sicurezza;
  • essere facilmente accessibile non solo da interfaccia nativa, web o altro ma fornire pure accesso ai dati da sistemi remoti tramite API o altri modi machine-friendly;
  • aggregare automaticamente e normalizzare i dati mantenendo la traccia di cosa è stato aggiunto o modificato, da chi e quando.

Secondo Panda security ogni giorno vengono prodotti più di 230.000 nuovi campioni di malware facendo sì, quindi, che una libreria possa facilmente contenere diversi milioni di esemplari. Essendo, di fatto, un archivio, si può assumere come modello generico di funzionamento lo standard OAIS.

Un oggetto da archiviare (nel nostro caso campioni di malware) vive in un archivio in almeno tre formati diversi:

  1. quello in cui viene depositato all’archivio;
  2. quello in cui viene fisicamente archiviato;
  3. quello in cui viene reso disponibile al ricercatore che ne fa richiesta.

Quando si sceglie il formato di deposito, ad esempio, bisogna specificare se il campione può arrivare criptato, eventualmente con password, oppure compresso, se deve essere un singolo file o se può contenere directory e così via. Inoltre, va concordato il mezzo di trasmissione, ad esempio via e-mail criptata o via SFTP.

Il processo di deposito in archivio comporta la trasformazione, senza perdita di informazioni, dal formato di deposito al formato di archiviazione, ma anche la classificazione, il riconoscimento se trattasi di un malware noto e l’eventuale scarto se il campione esiste già nell’archivio. Per quanto riguarda il riconoscimento di duplicati, può fare comodo l’uso di utility di Duplicate File Locator, come ad esempio questa o AllDup, tanto per citarne un paio. Ovviamente è necessario definire cosa si intende per duplicato: se, cioè, file con lo stesso nome, con la stessa prima parte del nome, con gli stessi contenuti o anche con lo stesso hash o checksum CRC.

Un altro aspetto da verificare in fase di deposito è che il file non sia corrotto o anche infettato. In quest’ultimo caso è importante avere a disposizione strumenti appositi per rimuovere tutto ciò che non interessa.

Librerie di malware: ecco come avviene la classificazione

La fase di classificazione deve seguire standard appropriati come ad esempio quello di CARO (the Computer Anti-virus Researchers’ Organization). In questo caso occorrerà creare nell’archivio un albero gerarchico di directory in cui i malware costituiscono le “foglie”.

WHITEPAPER
Come proporre soluzioni di Unified Communications: una guida per System Integrator
Cloud
Networking

Per ogni deposito, oltre al file devono essere raccolti opportuni metadati e altri ancora si aggiungeranno in fase di analisi. Occorre tenere presente che non tutti i metadati raccolti devono per forza essere pubblici dal momento che tra di essi ci potrebbero essere la descrizione di come e dove sono stati trovati, il nome dell’organizzazione infettata e altri dati anche sensibili. L’analisi, poi, restituirà in generale una serie di IOC (Indicatori di Compromissione), come indirizzi IP, URL, hash ecc. che accompagneranno il campione come metadati.

Se l’archivio prevede che i campioni vengano messi a disposizione di ricercatori esterni, devono essere stabilite le policy di utilizzo e, in particolare, le modalità di accesso (ad esempio utente registrato o no, utente proveniente da istituzioni riconosciute o no ecc.), i formati di download, sottoscrizione di un agreement di usare i campioni solo a fini di studio e così via. Eventualmente è possibile anche pensare a un accesso utente a due livelli: al primo è possibile visionare tutte le caratteristiche del malware mentre al secondo è possibile anche scaricare un campione dello stesso, il che permetterebbe di distinguere tra un utente generico e uno specialista.

Tra le librerie indichiamo:

Evoluzione dei malware

Il “riuso del codice” è una pratica anzi, potremmo dire, una best practice, che costituisce un obiettivo dello sviluppo software probabilmente a partire da quando si parla di ingegneria del software. Esso ha portato alla nascita del concetto di sviluppo per librerie, componenti, moduli, controlli e così via che costituiscono i blocchi costruttivi da assemblare e integrare per costruire un qualsiasi programma. Lo stesso concetto vale anche per i malware. Questi, come virus e worm, sono spesso riferiti a malware precedenti attraverso relazioni evoluzionistiche. Scoprire queste relazioni e costruire un modello filogenetico è utile per analizzare nuovi malware e per stabilire dei criteri di nomenclatura.

Gli autori di malware usano generatori, incorporano librerie e prendono in prestito codice da altri. Esiste una rete consolidata, soprattutto nel Dark Web, per lo scambio di codice malevolo.

La filogenesi (o filogenetica o filogenia) è un termine mutuato dalla biologia dove indica il processo di ramificazione delle linee di discendenza nell’evoluzione della vita. La sua ricostruzione è fondamentale per la sistematica che si occupa di ricostruire le relazioni di parentela evolutiva, di gruppi tassonomici di organismi a qualunque livello sistematico. Il diagramma che mostra i rapporti filogenetici tra specie o gruppi superiori si chiama albero filogenetico (fonte Wikipedia).

I due approcci principali al problema si basano su:

  • l’osservazione di un organismo dal punto di vista morfologico cioè sostanzialmente come è fatto e cosa fa (es. come corre, come mangia, il numero di arti, il modo di riprodursi, se ha degli occhi ecc.);
  • l’osservazione di un organismo dal punto di vista costitutivo, cioè da cosa è composto, il che viene fatto con l’analisi biochimica o della sequenza del DNA.

Se ribaltiamo quanto appena visto allo studio di un malware questi due approcci si traducono in due tecniche:

  • l’analisi di un software in termini delle funzionalità e del comportamento che espone;
  • le sequenze di codice da cui è composto.

Nel primo caso si può supporre di partire da un malware p e, attraverso l’applicazione di un certo numero di operazioni di offuscamento T, che vedremo in un articolo successivo, generare un nuovo malware p’=T(p).

Nel secondo, invece, si tratta di capire se esistono pezzi di codice in comune.

In entrambi i casi portare quello che si sa in ambito biologico, in termini di metodologie soprattutto, in ambito informatico può certamente aiutare.

Le tecniche per individuare i malware

L’albero dei suffissi (suffix tree), ad esempio, è una tecnica che aiuta a ricercare, in tempi ragionevoli, sottostringhe, di lunghezza arbitraria, all’interno di una stringa data. Esso quindi permette di risolvere il problema:

Data una stringa T (chiamata testo) e una stringa P (chiamata pattern), trovare tutte le occorrenze di P in T. Un’occorrenza di P in T è una sottostringa di T uguale a P.

Ad esempio:

T = ATACATACCCATATACGAGGCATACATGGCGAGTGTGC

P = CGAG

Con i modelli di tipo edit distance si cerca di quantificare le differenze tra due stringhe contando il numero minimo di operazioni necessario per trasformare una nell’altra. Questa tecnica, ad esempio, viene utilizzata nel processamento del linguaggio naturale per la correzione automatica di parole scritte male selezionando parole da un dizionario che si trovino a breve distanza da una parola data. In bioinformatica, ciò può essere usato per quantificare la somiglianza di sequenze di DNA. Tra le operazioni previste per la trasformazione ci possono essere ad esempio inserimento, eliminazione, sostituzione di un singolo carattere oppure trasposizioni di due caratteri adiacenti oppure anche merge o split.

Un’ulteriore tecnica sono gli algoritmi MSA (Multiple sequence alignments). Questa si riferisce al fatto di localizzare in stringhe diverse sequenze di stringhe uguali intervallate da altri caratteri. Nella bioinformatica, le sequenze possono essere sequenze di DNA, RNA o proteine che hanno regioni simili l’una con l’altra a causa di relazioni strutturali, funzionali o evolutive. Ad esempio, in figura è mostrato l’esistenza di sequenze di stringhe uguali all’interno di proteine di specie di mammiferi diverse.

Nel caso del malware queste tecniche servono ovviamente a trovare sequenze di codice uguale in campioni diversi.

Una rappresentazione grafica dell’algoritmo MSA

Ulteriori metodi di machine learning di analisi dei malware utilizzano gli n-grammi. Data una stringa, gli n-grammi sono tutte le sottostringhe di lunghezza fissa n. Ad esempio, la stringa “MALWARE” può essere segmentata in diversi 4-grammi: “MALW”, “ALWA”, “LWAR”, “WARE” e così via. Relativamente al codice di un malware, che sarebbe la nostra “stringa di partenza”, è possibile lavorare con granularità variabile, a seconda che si lavori a livello di singoli byte, oppure di istruzioni assembler o di intere linee di codice. Tipicamente l’analisi riguarda tutti gli n-grammi con n che va da 1 a 10 e, come prima cosa, si misura quante volte, cioè la frequenza, con cui ogni n-gramma capita nel codice del malware. Avremo così alla fine un certo numero di coppie chiave-valore in cui la chiave è lo specifico n-gramma e il valore è quante volte viene trovato nel testo. Questo insieme per un malware sconosciuto viene dato in pasto a una macchina a cui è stato dato in apprendimento lo stesso insieme per il numero più grosso possibile di malware noti. In tal modo, l’algoritmo dovrebbe riuscire a estrarre eventuali situazioni simili già note.

Un’altra metodologia per scoprire le somiglianze tra i malware è quella delle Chernoff face. È una tecnica di analisi dei dati semi-automatica che trasforma insiemi di attributi di una variabile in caratteristiche di una faccia come, ad esempio, la forma e la posizione di occhi, orecchi, sopracciglia ecc. In questo modo si sfrutta l’elevata capacità del cervello umano di riconoscere le differenze nelle facce: facce simili vogliono dire campioni simili, cioè appartenenti allo stesso cluster. Nel nostro caso, gli strumenti di analisi estraggono dai malware una serie di indicatori che vengono visualizzati attraverso questa tecnica, consentendo così all’analista umano di riconoscere a colpo d’occhio, è proprio il caso di dire, campioni che potrebbero appartenere alle stesse famiglie.

La metodologia Chernoff face usata per scoprire somiglianze tra i malware.

WHITEPAPER
Trend e prospettive future nel mercato del log management
Sicurezza
Cybersecurity
@RIPRODUZIONE RISERVATA

Speciale PNRR

Tutti
Incentivi
Salute digitale
Formazione
Analisi
Sostenibilità
PA
Sostemibilità
Sicurezza
Digital Economy
CODICE STARTUP
Imprenditoria femminile: come attingere ai fondi per le donne che fanno impresa
DECRETI
PNRR e Fascicolo Sanitario Elettronico: investimenti per oltre 600 milioni
IL DOCUMENTO
Competenze digitali, ecco il nuovo piano operativo nazionale
STRUMENTI
Da Istat e RGS gli indicatori per misurare la sostenibilità nel PNRR
STRATEGIE
PNRR – Piano nazionale di Ripresa e Resilienza: cos’è e novità
FONDI
Pnrr, ok della Ue alla seconda rata da 21 miliardi: focus su 5G e banda ultralarga
GREEN ENERGY
Energia pulita: Banca Sella finanzia i progetti green incentivati dal PNRR
TECNOLOGIA SOLIDALE
Due buone notizie digitali: 500 milioni per gli ITS e l’inizio dell’intranet veloce in scuole e ospedali
INNOVAZIONE
Competenze digitali e InPA cruciali per raggiungere gli obiettivi del Pnrr
STRATEGIE
PA digitale 2026, come gestire i fondi PNRR in 5 fasi: ecco la proposta
ANALISI
Value-based healthcare: le esperienze in Italia e il ruolo del PNRR
Strategie
Accordi per l’innovazione, per le imprese altri 250 milioni
Strategie
PNRR, opportunità e sfide per le smart city
Strategie
Brevetti, il Mise mette sul piatto 8,5 milioni
Strategie
PNRR e opere pubbliche, la grande sfida per i Comuni e perché bisogna pensare digitale
Formazione
Trasferimento tecnologico, il Mise mette sul piatto 7,5 milioni
Strategie
PSN e Strategia Cloud Italia: a che punto siamo e come supportare la PA in questo percorso
Dispersione idrica
Siccità: AI e analisi dei dati possono ridurre gli sprechi d’acqua. Ecco gli interventi necessari
PNRR
Cloud, firmato il contratto per l’avvio di lavori del Polo strategico
Formazione
Competenze digitali, stanziati 48 milioni per gli Istituti tecnologici superiori
Iniziative
Digitalizzazione delle reti idriche: oltre 600 milioni per 21 progetti
Competenze e competitività
PNRR, così i fondi UE possono rilanciare la ricerca e l’Università
Finanziamenti
PNRR, si sbloccano i fondi per l’agrisolare
Sanità post-pandemica
PNRR, Missione Salute: a che punto siamo e cosa resta da fare
Strategie
Sovranità e autonomia tecnologica nazionale: come avviare un processo virtuoso e sostenibile
La relazione
Pnrr e PA digitale, l’alert della Corte dei conti su execution e capacità di spesa
L'editoriale
Elezioni 2022, la sfida digitale ai margini del dibattito politico
Strategie
Digitale, il monito di I-Com: “Senza riforme Pnrr inefficace”
Transizione digitale
Pnrr: arrivano 321 milioni per cloud dei Comuni, spazio e mobilità innovativa
L'analisi I-COM
Il PNRR alla prova delle elezioni: come usare bene le risorse e centrare gli obiettivi digitali
Cineca
Quantum computing, una svolta per la ricerca: lo scenario europeo e i progetti in corso
L'indice europeo
Desi, l’Italia scala due posizioni grazie a fibra e 5G. Ma è (ancora) allarme competenze
L'approfondimento
PNRR 2, ecco tutte le misure per cittadini e imprese: portale sommerso, codice crisi d’impresa e sismabonus, cosa cambia
Servizi digitali
PNRR e trasformazione digitale: ecco gli investimenti e le riforme previste per la digitalizzazione della PA
Legal health
Lo spazio europeo dei dati sanitari: come circoleranno le informazioni sulla salute nell’Unione Europea
Servizi digitali
PNRR e PA digitale: non dimentichiamo la dematerializzazione
Digital Healthcare transformation
La trasformazione digitale degli ospedali
Governance digitale
PA digitale, è la volta buona? Così misure e risorse del PNRR possono fare la differenza
Servizi digitali
Comuni e digitale, come usare il PNRR senza sbagliare
La survey
Pnrr e digitale accoppiata vincente per il 70% delle pmi italiane
Missione salute
Fascicolo Sanitario Elettronico alla prova del PNRR: limiti, rischi e opportunità
Servizi pubblici
PNRR: come diventeranno i siti dei comuni italiani grazie alle nuove risorse
Skill gap
PNRR, la banda ultra larga crea 20.000 nuovi posti di lavoro
Il Piano
Spazio, Colao fa il punto sul Pnrr: i progetti verso la milestone 2023
FORUMPA2022
PNRR e trasformazione digitale: rivedi i Talk di FORUM PA 2022 in collaborazione con le aziende partner
I contratti
Avio, 340 milioni dal Pnrr per i nuovi propulsori a metano
Next Generation EU
PNRR, a che punto siamo e cosa possono aspettarsi le aziende private
Fondi
Operativo il nuovo portale del MISE con tutti i finanziamenti per le imprese
Servizi comunali
Il PNRR occasione unica per i Comuni digitali: strumenti e risorse per enti e cittadini
Healthcare data platform
PNRR dalla teoria alla pratica: tecnologie e soluzioni per l’innovazione in Sanità
Skill
Competenze digitali, partono le Reti di facilitazione
Gli obiettivi
Scuola 4.0, PNRR ultima chance: ecco come cambierà il sistema formativo
Sistema Paese
PNRR 2, è il turno della space economy
FORUM PA 2022
FORUM PA 2022: la maturità digitale dei comuni italiani rispetto al PNRR
Analisi
PNRR: dalla Ricerca all’impresa, una sfida da cogliere insieme
Innovazione
Pnrr, il Dipartimento per la Trasformazione digitale si riorganizza
FORUM PA 2022
PA verde e sostenibile: il ruolo di PNRR, PNIEC, energy management e green public procurement
Analisi
PNRR, Comuni e digitalizzazione: tutto su fondi e opportunità, in meno di 3 minuti. Guarda il video!
Rapporti
Competenze digitali e servizi automatizzati pilastri del piano Inps
Analisi
Attuazione del PNRR: il dialogo necessario tra istituzioni e società civile. Rivedi lo Scenario di FORUM PA 2022
Progetti
Pnrr, fondi per il Politecnico di Torino. Fra i progetti anche IS4Aerospace
Analisi
PNRR, Colao fa il punto sulla transizione digitale dell’Italia: «In linea con tutte le scadenze»
La Svolta
Ict, Istat “riclassifica” i professionisti. Via anche al catalogo dati sul Pnrr
Analisi
Spazio, Colao fa il punto sul Pnrr: i progetti verso la milestone 2023
FORUM PA 2022
Ecosistema territoriale sostenibile: l’Emilia Romagna tra FESR e PNRR
Il Piano
Innovazione, il Mise “centra” gli obiettivi Pnrr: attivati 17,5 miliardi
Analisi
PNRR: raggiunti gli obiettivi per il primo semestre 2022. Il punto e qualche riflessione
Analisi
PNRR: dal dialogo tra PA e società civile passa il corretto monitoraggio dei risultati, tra collaborazione e identità dei luoghi
Webinar
Comuni e PNRR: un focus sui bandi attivi o in pubblicazione
Analisi
Formazione 4.0: cos’è e come funziona il credito d’imposta
PA e Sicurezza
PA e sicurezza informatica: il ruolo dei territori di fronte alle sfide della digitalizzazione
PA e sicurezza
PNRR e servizi pubblici digitali: sfide e opportunità per Comuni e Città metropolitane
Water management
Water management in Italia: verso una transizione “smart” e “circular” 
LE RISORSE
Transizione digitale, Simest apre i fondi Pnrr alle medie imprese
Prospettive
Turismo, cultura e digital: come spendere bene le risorse del PNRR
Analisi
Smart City: quale contributo alla transizione ecologica
Decarbonizzazione
Idrogeno verde, 450 milioni € di investimenti PNRR, Cingolani firma
Unioncamere
PNRR, imprese in ritardo: ecco come le Camere di commercio possono aiutare
I fondi
Industria 4.0: solo un’impresa su tre pronta a salire sul treno Pnrr
CODICE STARTUP
Imprenditoria femminile: come attingere ai fondi per le donne che fanno impresa
DECRETI
PNRR e Fascicolo Sanitario Elettronico: investimenti per oltre 600 milioni
IL DOCUMENTO
Competenze digitali, ecco il nuovo piano operativo nazionale
STRUMENTI
Da Istat e RGS gli indicatori per misurare la sostenibilità nel PNRR
STRATEGIE
PNRR – Piano nazionale di Ripresa e Resilienza: cos’è e novità
FONDI
Pnrr, ok della Ue alla seconda rata da 21 miliardi: focus su 5G e banda ultralarga
GREEN ENERGY
Energia pulita: Banca Sella finanzia i progetti green incentivati dal PNRR
TECNOLOGIA SOLIDALE
Due buone notizie digitali: 500 milioni per gli ITS e l’inizio dell’intranet veloce in scuole e ospedali
INNOVAZIONE
Competenze digitali e InPA cruciali per raggiungere gli obiettivi del Pnrr
STRATEGIE
PA digitale 2026, come gestire i fondi PNRR in 5 fasi: ecco la proposta
ANALISI
Value-based healthcare: le esperienze in Italia e il ruolo del PNRR
Strategie
Accordi per l’innovazione, per le imprese altri 250 milioni
Strategie
PNRR, opportunità e sfide per le smart city
Strategie
Brevetti, il Mise mette sul piatto 8,5 milioni
Strategie
PNRR e opere pubbliche, la grande sfida per i Comuni e perché bisogna pensare digitale
Formazione
Trasferimento tecnologico, il Mise mette sul piatto 7,5 milioni
Strategie
PSN e Strategia Cloud Italia: a che punto siamo e come supportare la PA in questo percorso
Dispersione idrica
Siccità: AI e analisi dei dati possono ridurre gli sprechi d’acqua. Ecco gli interventi necessari
PNRR
Cloud, firmato il contratto per l’avvio di lavori del Polo strategico
Formazione
Competenze digitali, stanziati 48 milioni per gli Istituti tecnologici superiori
Iniziative
Digitalizzazione delle reti idriche: oltre 600 milioni per 21 progetti
Competenze e competitività
PNRR, così i fondi UE possono rilanciare la ricerca e l’Università
Finanziamenti
PNRR, si sbloccano i fondi per l’agrisolare
Sanità post-pandemica
PNRR, Missione Salute: a che punto siamo e cosa resta da fare
Strategie
Sovranità e autonomia tecnologica nazionale: come avviare un processo virtuoso e sostenibile
La relazione
Pnrr e PA digitale, l’alert della Corte dei conti su execution e capacità di spesa
L'editoriale
Elezioni 2022, la sfida digitale ai margini del dibattito politico
Strategie
Digitale, il monito di I-Com: “Senza riforme Pnrr inefficace”
Transizione digitale
Pnrr: arrivano 321 milioni per cloud dei Comuni, spazio e mobilità innovativa
L'analisi I-COM
Il PNRR alla prova delle elezioni: come usare bene le risorse e centrare gli obiettivi digitali
Cineca
Quantum computing, una svolta per la ricerca: lo scenario europeo e i progetti in corso
L'indice europeo
Desi, l’Italia scala due posizioni grazie a fibra e 5G. Ma è (ancora) allarme competenze
L'approfondimento
PNRR 2, ecco tutte le misure per cittadini e imprese: portale sommerso, codice crisi d’impresa e sismabonus, cosa cambia
Servizi digitali
PNRR e trasformazione digitale: ecco gli investimenti e le riforme previste per la digitalizzazione della PA
Legal health
Lo spazio europeo dei dati sanitari: come circoleranno le informazioni sulla salute nell’Unione Europea
Servizi digitali
PNRR e PA digitale: non dimentichiamo la dematerializzazione
Digital Healthcare transformation
La trasformazione digitale degli ospedali
Governance digitale
PA digitale, è la volta buona? Così misure e risorse del PNRR possono fare la differenza
Servizi digitali
Comuni e digitale, come usare il PNRR senza sbagliare
La survey
Pnrr e digitale accoppiata vincente per il 70% delle pmi italiane
Missione salute
Fascicolo Sanitario Elettronico alla prova del PNRR: limiti, rischi e opportunità
Servizi pubblici
PNRR: come diventeranno i siti dei comuni italiani grazie alle nuove risorse
Skill gap
PNRR, la banda ultra larga crea 20.000 nuovi posti di lavoro
Il Piano
Spazio, Colao fa il punto sul Pnrr: i progetti verso la milestone 2023
FORUMPA2022
PNRR e trasformazione digitale: rivedi i Talk di FORUM PA 2022 in collaborazione con le aziende partner
I contratti
Avio, 340 milioni dal Pnrr per i nuovi propulsori a metano
Next Generation EU
PNRR, a che punto siamo e cosa possono aspettarsi le aziende private
Fondi
Operativo il nuovo portale del MISE con tutti i finanziamenti per le imprese
Servizi comunali
Il PNRR occasione unica per i Comuni digitali: strumenti e risorse per enti e cittadini
Healthcare data platform
PNRR dalla teoria alla pratica: tecnologie e soluzioni per l’innovazione in Sanità
Skill
Competenze digitali, partono le Reti di facilitazione
Gli obiettivi
Scuola 4.0, PNRR ultima chance: ecco come cambierà il sistema formativo
Sistema Paese
PNRR 2, è il turno della space economy
FORUM PA 2022
FORUM PA 2022: la maturità digitale dei comuni italiani rispetto al PNRR
Analisi
PNRR: dalla Ricerca all’impresa, una sfida da cogliere insieme
Innovazione
Pnrr, il Dipartimento per la Trasformazione digitale si riorganizza
FORUM PA 2022
PA verde e sostenibile: il ruolo di PNRR, PNIEC, energy management e green public procurement
Analisi
PNRR, Comuni e digitalizzazione: tutto su fondi e opportunità, in meno di 3 minuti. Guarda il video!
Rapporti
Competenze digitali e servizi automatizzati pilastri del piano Inps
Analisi
Attuazione del PNRR: il dialogo necessario tra istituzioni e società civile. Rivedi lo Scenario di FORUM PA 2022
Progetti
Pnrr, fondi per il Politecnico di Torino. Fra i progetti anche IS4Aerospace
Analisi
PNRR, Colao fa il punto sulla transizione digitale dell’Italia: «In linea con tutte le scadenze»
La Svolta
Ict, Istat “riclassifica” i professionisti. Via anche al catalogo dati sul Pnrr
Analisi
Spazio, Colao fa il punto sul Pnrr: i progetti verso la milestone 2023
FORUM PA 2022
Ecosistema territoriale sostenibile: l’Emilia Romagna tra FESR e PNRR
Il Piano
Innovazione, il Mise “centra” gli obiettivi Pnrr: attivati 17,5 miliardi
Analisi
PNRR: raggiunti gli obiettivi per il primo semestre 2022. Il punto e qualche riflessione
Analisi
PNRR: dal dialogo tra PA e società civile passa il corretto monitoraggio dei risultati, tra collaborazione e identità dei luoghi
Webinar
Comuni e PNRR: un focus sui bandi attivi o in pubblicazione
Analisi
Formazione 4.0: cos’è e come funziona il credito d’imposta
PA e Sicurezza
PA e sicurezza informatica: il ruolo dei territori di fronte alle sfide della digitalizzazione
PA e sicurezza
PNRR e servizi pubblici digitali: sfide e opportunità per Comuni e Città metropolitane
Water management
Water management in Italia: verso una transizione “smart” e “circular” 
LE RISORSE
Transizione digitale, Simest apre i fondi Pnrr alle medie imprese
Prospettive
Turismo, cultura e digital: come spendere bene le risorse del PNRR
Analisi
Smart City: quale contributo alla transizione ecologica
Decarbonizzazione
Idrogeno verde, 450 milioni € di investimenti PNRR, Cingolani firma
Unioncamere
PNRR, imprese in ritardo: ecco come le Camere di commercio possono aiutare
I fondi
Industria 4.0: solo un’impresa su tre pronta a salire sul treno Pnrr

Articolo 1 di 4